February-March 2023
- FMDV SAT2 outbreaks in Iraq and Jordan due to SAT2/XIV
- Results presented here are a preliminary evaluation of a second real-time RT-PCR assay for the detection of SAT2/XIV viruses that have caused these outbreaks
Primers and probes are listed in the table below.
Oligo Name | Sequence (5’-3’) | Location (based on SAT2/ETH/2/2022 full genome) |
Use |
---|---|---|---|
SAT2_XIV_AS_P |
CCTCCACTGCCATCCGCGGTGAYAGG | 3663-3688 | Probe * |
SAT2_XIV_AS_F | ACCGTGTACAACGGTGAGTG | 3629-3648 | Forward primer |
SAT2_XIV_AS_R | TCAGCGTACTTGGCCRCAAG | 3714-3695 | Reverse primer |
* Probe oligonucleotide should be ordered to contain the appropriate reporter and quencher for your real time PCR system.
Assay protocol and amplification conditions:
The SAT2/XIV lineage-specific assay has been designed to have identical reagent and cycling conditions as the pan-FMDV real-time RT-PCR assay described in the WOAH manual (Callahan et al., 2002) and preliminary testing at the WRLFMD indicates that these condition are suitable for this test. Therefore, we suggest that laboratories use their existing real-time RT-PCR strategies (reagents and cycling conditions) and simply replace the 3D or 5’UTR primers and probe with the primers and probe (described above).
07/03/2023 Results from initial testing of new assay at the WRLFMD:
This latest assay has been shown to be able to detect nucleic acid extracted from a sample containing SAT/XIV FMD virus from Iraq where Ct values were broadly equivalent to the results from the pan-serotypic 3D real-time RT-PCR. Preliminary lineage specificity testing indicates that this assay does not detect FMD viruses from serotype O (O/EA-3, O/ME-SA/PanAsia-2ANT-10, O/ME-SA/PanAsia-2QOM-15, O/ME-SA/Ind-2001e), serotype A (A/ASIA/Iran-05), serotype Asia 1 (Sindh-08) and serotype SAT2 (VII).
November 2017
- RT-PCR summary sheet now updated to include the A/ASIA/G-VII lineage-specific assay.
- Updated leaflets to follow
Each leaflet describes an assay for particular FMDV lineages expected to be circulating in a geographical location. A summary of all these real-time RT-PCR assays (found in all the leaflets) can be found here.
East Africa
This set of specific assays was designed for the detection of FMDV strains currently circulating in the region of East Africa especially Tanzania, Uganda and Kenya (Bachanek-Bankowska et al., 2016)
Designed to detect: O/EA-2, O/EA-4, A/Africa/G-I, SAT 1/I(NWZ) and SAT 2/IV
West Eurasia
This set of real-time RT-PCR type-specific as-says was designed for the detection of FMDV strains currently circulating in West Eurasia (Reid et al., 2014).
Designed to detect: O/ME-SA/PanAsia-2, A/ASIA/Iran- 05, Asia1/ASIA/Group 1, Asia1/ASIA/Group 2 and Asia1/ASIA/Group 6
O/Ind-2001
This FMDV-O Ind-2001-specific real-time RT-PCR is a molecular tool for detection of foot-and-mouth Disease virus O/ME-SA/Ind2001 lineage (Knowles et al., 2014).
This lineage was originally detected on the Indian sub-continent, but has since spread westwards through the Middle East to North Africa and eastwards into Southeast Asia
Designed to detect: O/ME-SA/Ind-2001d
SAT 2 - Egypt
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus SAT 2/VII topotype and was developed in response to the SAT 2 outbreak in Egypt in 2012 (Ahmed et al., 2012).
Outside of Egypt this lineage has been detected in Libya, Palestinian Autonomous Territories, Eritrea and Cameroon.
Designed to detect: SAT 2/VII
A/G-VII
This FMDV-A lineage-VII-specific real-time RT-PCR is a molecular tool for detection of foot-and-mouth Disease virus A/ASIA/G-VII lineage (Saduakassova et al., 2018).
This lineage was originally detected on the Indian sub-continent, but has since spread through western Asia.
Designed to detect: A/ASIA/G-VII